MOMA-313 is a potent, selective Polθ inhibitor that enhances response to PARP inhibition in HR-deficient tumor models

MOMA-313 is a potent, selective Polθ inhibitor that enhances response to PARP inhibition in HR-deficient tumor models Erica Evans, Michael Reutershan, Vinny Motwani, Kelly McGlynn, Yonghong Bai, Christopher Quinn, Manaswni Dhingra, Cen Gao, David Waller, Salah Nabhan, Timothy Guzi, Peter Hammerman, and Jordan Krall MOMA Therapeutics, Cambridge, Massachusetts, USA MOMA-313 synergizes with PARP inhibitors in HR-deficient cell lines PARP inhibitor (+ MOMA-313) Loewe synergy score Assessment Olaparib 14.2 Synergistic Rucaparib 13.8 Synergistic Niraparib 10.1 Synergistic Veliparib 9.1 Synergistic Talazoparib 9.6 Synergistic Saruparib (Parp1-selective) 10.3 Synergistic [MOMA-313], µM Cell viability [% of DMSO] 0.0001 0.001 0.01 0.1 1 10 0 50 100 48 72 96 120 0 10 20 30 40 Apoptosis Time (h) CC3-positive cells [percentage of total cells] DMSO MOMA-313 (30 nM) olaparib (300 nM) saruparib (5 nM) MOMA-313 + olaparib MOMA-313 + saruparib * all compounds dosed at cell viability IC90 levels 48 72 96 120 0 10 20 30 DNA Damage Time (h) gH2AX-positive cells [percentage of total cells] • MOMA-313 displays class-wide synergy with PARP inhibitors against HR-deficient cells • Combinations accentuate DNA damage and apoptosis even at high target coverage • Strong selectivity profile: no impact of combination treatment on HR-proficient cells Abstract Background: DNA polymerase theta (Polθ) is an enzyme involved in DNA double- strand break (DSB) repair. Polθ contains an N-terminal ATPase- powered DNA helicase domain and a C-terminal DNA polymerase domain that work in tandem to repair DSBs through theta-mediated end-joining (TMEJ). In most contexts, Polθ activity is not required, as homologous recombination (HR) functions as the preferred pathway to repair DSBs that arise during DNA replication. However, genes required for HR-mediated DNA repair are commonly mutated or deleted in tumors, creating a strong dependence on Polθ-mediated TMEJ for the repair of DSBs and cell survival. MOMA-313 is a novel, potent, and selective inhibitor of Polθ helicase activity crafted to exploit the impaired DNA repair capabilities of HR-deficient tumors for potential therapeutic benefit. Results: MOMA-313 is a potent inhibitor of Polθ helicase activity that strongly inhibited TMEJ repair and drove apoptosis in HR-deficient contexts in vitro and in vivo. MOMA-313 synergized with PARP inhibitors, used as standard of care therapies for HR-deficient tumors, to enhance DNA damage, apoptosis, and antiproliferative activity in HR-deficient but not HR-proficient cell lines. MOMA-313 abrogated in vivo TMEJ activity when dosed at 3-10 mg/kg twice daily and displayed antitumor activity in HR-deficient tumors when combined with the PARP inhibitor olaparib. Antitumor activity with MOMA-313 and olaparib in HR- deficient cell line xenografts and PDXs significantly exceeded the antitumor activity seen with either agent alone and was well tolerated at all doses. MOMA-313 represents a promising new therapy for HR deficient tumors and is currently in phase 1 clinical testing. MOMA-313 phase 1 clinical trial initiated (NCT06545942) MOMA-313 monotherapy arm MOMA-313 combination arm with olaparib Dose Escalation Dose Expansion Dose Optimization • Locally advanced or metastatic solid tumors with prior PARP inhibitor exposure • Genetic biomarkers of HR-deficiency eligible • BLRM escalation design for both monotherapy and combination arms Dose Escalation Dose Expansion Dose Optimization • Escalation: PARP inhibitor exposed or naïve solid tumors with HR deficiencies including BRCA1, BRCA2, CDK12, PALB2, RAD51B/C/D mutations • Combination cohorts initiate after evaluation of initial MOMA-313 monotherapy dose-levels • Expansion and optimization: PARP inhibitor-naïve metastatic CRPC, breast, or pancreatic tumors with HR deficiencies MOMA-313 displays potent and selective efficacy against HR-deficient cell lines 0.0001 0.001 0.01 0.1 1 10 0 50 100 [MOMA-313], µM Cellular Polθ Activity [% of 13-bp deletion product] IC50 = 4 nM GCCAAGCAAAGTATCAGGGCAAAGTGTACA CGGTTCGTTTCATAGTCCCGTTTCACATGT Microhomology GCCAA-------------GCAAAGTGTACA CGGTT-------------CGTTTCACATGT 13-bp deletion DSB DNA repair product from NGS data Genomic sequence Polθ (TMEJ) 0.0001 0.001 0.01 0.1 1 10 0 50 100 [MOMA-313], µM Cell viability [% of DMSO] DLD1-BRCA2-/- DLD1 (parental) DoTc24510 MDA-MB-231 BRCA2-deficient: HR-proficient: MOMA-313 potently inhibits the cell viability of multiple HR-deficient cell lines across multiple genotypes Recombinant Protein ATPase IC50 Human Polθ 0.7 nM Human Blm 45,900 nM Human Smarca2 > 50,000 nM Human Smarca4 > 50,000 nM Human Wrn > 50,000 nM 0.0001 0.001 0.01 0.1 1 10 100 0 20 40 60 80 100 [MOMA-313], µM Protein ATPase activity [% of DMSO] Blm Smarca2 Smarca4 WrnPolθ Cell Line IC50 Status Alteration DLD1-BRCA2-/- 2.7 nM HR-deficient BRCA2-KO DoTc24510 2.4 nM HR-deficient BRCA2-mut Capan-1 534 nM HR-deficient BRCA2-mut KP363T 0.2 nM HR-deficient RAD51C-methyl. SNU-601 0.5 nM HR-deficient RAD51C-methyl. DLD1 (parental) > 10,000 nM HR-proficient --- MDA-MB-231 > 10,000 nM HR-proficient --- Strong selectivity profile: No activity observed in HR-proficient cell lines with MOMA-313 concentrations up to 10 µM MOMA-313 is a potent and selective inhibitor of human Polθ ATPase activity Basal 0 0.1 0.3 1 3 10 0 10 20 30 40 TMEJ Repair Product (percent of edited reads) [MOMA-313] mg/kg BID Dox-induced DNA DSB No Dox Vehicle 0.1 mg/kg BID 0.3 mg/kg BID 1 mg/kg BID 3 mg/kg BID 10 mg/kg BID Polθ-independent DNA repair MOMA-313 dose: In vivo TMEJ assay: repair of a doxycycline-induced CRISPR-targeted DSB MOMA-313 inhibits in vivo TMEJ and drives tumor regressions in combination with olaparib 0 7 14 21 28 -20 -10 0 10 20 Time (d) Body weight [% change from day 0] Vehicle olaparib (100 mg/kg QD) MOMA-313 (0.3 mg/kg BID) + olaparib (100 mg/kg QD) MOMA-313 (1 mg/kg BID) + olaparib (100 mg/kg QD) MOMA-313 (3 mg/kg BID) + olaparib (100 mg/kg QD) MOMA-313 (10 mg/kg BID) + olaparib (100 mg/kg QD) MOMA-313 (10 mg/kg BID) 0 10 20 30 0 500 1000 1500 2000 2500 Time (d) Tumor Volume (mm3) MOMA-313 displays dose-dependent combination efficacy with olaparib (DLD1-BRCA2-/- CDX) 0 10 20 30 0 500 1000 1500 2000 2500 Time (d) Tumor Volume (mm3) Vehicle olaparib (100 mg/kg QD) olaparib (100 mg/kg QD) olaparib (30 mg/kg QD) olaparib (30 mg/kg QD) olaparib (10 mg/kg QD) olaparib (10 mg/kg QD) MOMA-313 (10 mpk BID) MOMA-313 (10 mg/kg BID) plus Single-agent olaparib Dose-dependent and saturating inhibition of Polθ-activity within established DLD-1 tumor xenografts MOMA-313 drives dose-dependent tumor regressions and produces robust combination benefit across a wide range of olaparib doses in DLD1-BRCA2-/- xenograft model MOMA-313 retains efficacy with reduced olaparib doses Summary • MOMA-313 is a potent and selective inhibitor of the Polθ helicase domain in clinical development for the treatment of HR-deficient tumors • MOMA-313 potently inhibits Polθ-dependent TMEJ and selectively kills HR-deficient cancer cells • MOMA-313 displays class-wide synergy with PARP inhibitors in vitro and drives deeper responses in HR-deficient CDX and PDX tumor models in combination with olaparib than either agent alone • MOMA-313 phase 1 clinical trial initiated in August 2024 and currently enrolling (NCT06545942) Dose dependent inhibition of TMEJ repair product formation after targeted DNA DSB in DLD-1 cells MOMA-313 olaparib 3 µM 0.0007 nM MOMA-313 plus olaparib regresses BRCAmut PDX models 0 7 14 21 28 35 42 0 1000 2000 Time (d) Vehicle MOMA-313 (30 mg/kg BID) olaparib (100 mg/kg QD) MOMA-313 (30 mg/kg BID) + olaparib (100 mg/kg QD) BRCA2-mutant pancreatic PDX BRCA1-mutant pancreatic PDX • MOMA-313 displays dose-dependent efficacy and drives tumor regressions in combination with olaparib against multiple BRCA-deficient PDX models in clinically relevant indications • Combination treatment is well-tolerated at all dose-levels tested 0 10 20 30 40 50 0 1000 2000 3000 Time (d) Tumor Volume (mm3) Vehicle MOMA-313 (30 mg/kg BID) olaparib (100 mg/kg QD) MOMA-313 (1,3,10,30 mg/kg BID) + olaparib (100 mg/kg QD) Loewe synergy matrixDoTc24510 cells (BRCA2mut) 2024 EORTC-NCI-AACR

The release as fetched from its publisher. momatx.com ↗